Accepted Manuscript Title: First detection of Anopheles stephensi Liston, 1901 (Diptera: Culicidae) in Ethiopia using molecular and morphological approaches Authors: Tamar E. Carter, Solomon Yared, Araya Gebresilassie, Victoria Bonnell, Lambodhar Damodaran, Karen Lopez, Mohammed Ibrahim, Seid Mohammed, Daniel Janies PII: DOI: Reference: S0001-706X(18)30561-8 https://doi.org/10.1016/j.actatropica.2018.09.001 ACTROP 4774 To appear in: Acta Tropica Received date: Revised date: Accepted date: 14-5-2018 1-9-2018 1-9-2018 Please cite this article as: Carter TE, Yared S, Gebresilassie A, Bonnell V, Damodaran L, Lopez K, Ibrahim M, Mohammed S, Janies D, First detection of Anopheles stephensi Liston, 1901 (Diptera: Culicidae) in Ethiopia using molecular and morphological approaches, Acta Tropica (2018), https://doi.org/10.1016/j.actatropica.2018.09.001 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. First detection of Anopheles stephensi Liston, 1901 (Diptera: Culicidae) in Ethiopia using molecular and morphological approaches. Tamar E. Carter1,2*+ Solomon Yared3*, Araya Gebresilassie3, Victoria Bonnell1, Lambodhar Department of Bioinformatics and Genomics, University of North Carolina at Charlotte, 9201 RI 1 PT Damodaran1, Karen Lopez1, Mohammed Ibrahim4, Seid Mohammed5, Daniel Janies1 2 SC University City Blvd, Charlotte, NC, 28223, USA Department of Biology, Baylor University, Waco, TX, 76798, USA Department of Biology, Jigjiga University, Jigjiga, Ethiopia, 4 College of Veterinary Medicine, Jigjiga University, Ethiopia 5 Department of Animal and Range Science, Jigjiga University, Jigjiga, Ethiopia M A N U 3 TE SY: solyar2005@yahoo.com D TC: tamar_carter@baylor.edu CC EP AG: arayagh2006@yahoo.com TB: vab18@psu.edu LD: ldamodar@uncc.edu A KL: klopez1@uncc.edu MI: fahmi32@hotmail.com SM: seid514@gmail.com 1 DJ: djanies@uncc.edu PT *Authors contributed equally. RI + Corresponding author SC Abstract U Malaria is a major public health concern in Ethiopia. With the increase in malaria cases in N the Somali Region of Ethiopia, understanding the distribution and identifying the species of A malaria vectors is vital to public health. Here we report the first detection of Anopheles M stephensi in Ethiopia, a malaria vector typically found in the Middle East, the Indian D subcontinent, and China, but recently found in Djibouti. TE An entomological investigation was conducted during November to December 2016 in Kebri Dehar town of the Ethiopian Somali Regional State as ancillary work for Anopheles spp. CC EP surveillance. Mosquito larvae were collected from water reservoirs. Larvae were reared in the laboratory to the adult stage and identified morphologically. PCR and sequencing of cytochrome oxidase 1 (COI) and internal transcribed spacer 2 (ITS2) loci were performed. Basic Local A Alignment Search Tool (BLAST) was used to compare sample sequences to sequences in the NCBI nucleotide database for species identification. To further analyze the relationship between the specimen we collected in Kebri Dehar and other Anopheles samples available in Genbank, phylogenetic analysis was performed using a maximum likelihood approach. 2 Molecular and morphological results confirm specimens were An. stephensi. The closest high scoring hit was for all specimens was for the An. stephensi sequence. Independent phylogenetic analyses of COI and ITS2 sequences revealed in both cases strong bootstrap (100) PT support for our sequence forming a clade with other An. stephensi sequences to the exclusion of any other species of Anopheles. In conclusion, Anopheles stephensi is present in Kebri Dehar RI town in Ethiopia. These findings highlight the need for additional research to examine the role of U SC An. stephensi in malaria transmission in Ethiopia. A N Keywords: Malaria, Anopheles stephensi, Kebri Dehar, phylogenetics, Horn of Africa M 1. Background D Malaria is a serious public health threat in Ethiopia, where over 68% of the population is TE at risk for infection and an average of 2.5 million cases are reported each year (World Malaria CC EP Report, 2017). Malaria transmission exhibits a seasonal and unstable pattern in Ethiopia, with transmission varying with altitude and rainfall (Alemu et al., 2011). The highest levels of malaria transmission are observed in the north, west, and eastern lowlands of Ethiopia (World Malaria Report, 2017). In the eastern lowlands such as Afar and Ethiopian Somali Regional State A (ESRS), malaria is endemic along the rivers where small-scale irrigation activities are practiced for agricultural purposes (Malaria programme review - Aide Memoire, 2011). Over the past few years, malaria has become a growing public health threat in multiple zones and districts in Eastern Ethiopia (Bekele, 2016; Mohammed, 2015). Environmental 3 changes are believed to be contributing with increased flooding being reported (Simane et al., 2016). With the migration of people in search of fertile land for crop production and livestock rearing along the river basin, there is concern that malaria transmission may continue to increase PT in and outside the region (Simane et al., 2016). In addition to human movement, there are questions about the role of the mosquito vector RI population in the recent increase of malaria cases. Plans for malaria intervention and policy SC benefit from the knowledge of the specific malaria vector(s), in different regions of Ethiopia. Various species of Anopheles exhibit different feeding and breeding patterns which in turn U dictate malaria transmission timing and seasonality (Gone et al., 2014; Massebo et al., 2015). N Thus, determining the species and their role in malaria transmission across Ethiopia are crucial M A for planning of malaria control efforts. To date, forty-four species and subspecies of anopheline mosquitoes have been D documented in Ethiopia (Systematic Catalog of Culicidae). The predominant malaria vector TE species in Ethiopia is Anopheles arabiensis (Massebo et al., 2013; Taye et al., 2006). Other CC EP common vectors include An. funestus, An. pharoensis, and An. nili (Krafsur, 1977; Lelisa et al., 2017; Taye et al., 2006). These species vary in breeding preferences and feeding behaviors. An. arabiensis is reported to feed both outdoors and indoors, is mostly zoophilic, and has exhibited both indoor and outdoor resting behavior (Gone et al., 2014; Kenea et al., 2016; Massebo et al., A 2015). An. arabiensis larvae have been found in seasonal habits of both natural and manmade sources (Kenea et al., 2011). An. funestus has demonstrated both endophilic and exophilic behaviors and has shown to be zoophilic in certain settings (Gone et al., 2014) and breed in agricultural related puddles (Kibret et al., 2014). An. pharoensis has exhibited exophagic behavior (Taye et al., 2006) and larvae have been detected in swamps and sand mining pools 4 (Kenea et al., 2011). Most studies on malaria vectors in Ethiopia have focused on the west, northern, and southern regions. However, entomological data on the Anopheles species composition and vector role in the eastern portion of Ethiopia are sparse. The limited mosquito PT surveys and molecular studies are due to remoteness and security challenges of the region. Accordingly, an entomological survey was undertaken with the aim of determining the RI bionomics of Anopheles mosquitoes in ESRS. Here we report the results of a study of Anopheles SC mosquitoes in ESRS in which we found Anopheles stephensi, a species primarily observed east N U of the Red Sea. A 2. Methods M 2.1. Description of study area D The current study was undertaken in Kebri Dehar, in the ESRS in eastern Ethiopia TE (Figure 1). Kebri Dehar is located 1035 km from Addis Ababa. The topography of the study area is predominantly lowland plain with an average altitude of 493 meters above sea level with CC EP a few foothills of higher altitude. The study area has a latitude and longitude of 6°44’25’’N, 44° A 16’38’’E, respectively. The area has sparse shrubs and trees, including different species of 5 TE D Figure 1. Map of study site Kebri Dehar. M A N U SC RI PT Acacia and incense trees. The climate of Kebri Dehar is characterized as tropical semiarid. The region's CC EP temperature ranges from 23-30 °C. The area has bimodal rainfall pattern. The first and main rainy season ‘Gu’ occurs from mid-April to the end of June. A secondary rainy season known as ‘Deyr’ occurs from early October to late December. Overall the annual precipitation averages A 200 mm. Despite these patterns, the rainfall pattern is variable making the area prone to recurrent droughts that can last several months. The inhabitants of the district are largely pastoralists, who raise cattle, camels, sheep and goats. Sorghum and maize are the main staple food crops in the area. Based on figures from the Ethiopian Central Statistical Agency in 2007, Kebri Dehar has an estimated population of 6 100,191 of whom 51,327 are men and 48,864 are women (Central Statistical Agency of Ethiopia, 2007). Typically, each house contains a cement tank used as a water reservoir. The type of house in the study area is mainly rectangular with a corrugated iron roof and cement walls. The study PT area was selected as a sentinel site of malaria and is sprayed with carbamate insecticides during active malaria season in collaboration with the Federal Ministry of Health (FMOH) and the RI Regional Health Bureau. SC 2.2. Larval sampling and morphology U Mosquito larvae and pupae were collected from the water reservoirs between November N to December 2016 (Figure 2). We selected 10 larval sites based on the presence and density of A larvae and pupae, and optimal time in the area. Dipping was done following WHO guidelines M and standard operating procedures for entomological surveillance techniques (World Health Organization, 1992). The anopheline larvae collected were recorded according to their stage of D development as either first to second instars (early) or third to fourth (late) instars. The larvae TE and pupae were transported to the field laboratory with jars and put in enamel trays. Larvae and pupae were reared at the field lab to adulthood in Kebri Dehar and they were maintained at 28 ± CC EP 20C and 70 ± 10% relative humidity. The pupae were sorted and transferred with pipettes from the enamel trays to beakers with small amounts of water. Each beaker was placed inside a cage for rearing. Pupae were provided with 10% sugar in the cage. After two to three days the pupae A emerged to adults and the cages were put in safe place protected from contamination, ants, and other insects. The adults were collected using an aspirator, transferred to paper cups, and killed using chloroform for further species identification using morphological keys. 7 PT RI SC U Figure 2. Collection of larvae from breeding habitats (water reservoirs) in Kebri Dehar town. N Emerged adults were identified to species level using dissecting microscope and A magnifying lenses at 10x magnification. Mosquitoes were identified to species based on M morphological characters of their palps, wings, abdomen and legs using standard identification keys (Gillies and Coetzee, 1987; Glick and Walter Reed Biosystemsatics Unit, 1992). Following D the identification of species based on morphological characters, 529 adult mosquito specimens CC EP TE were shipped to the University of North Carolina at Charlotte for molecular analysis. A 2.3. DNA extraction, amplification, and sequencing DNA was extracted from the head and thorax of the mosquitos using the DNeasy Blood and Tissue Kit (Qiagen, Valencia, CA). The polymerase chain reaction (PCR) was performed for each individual mosquito, targeting the mitochondrial cytochrome c oxidase subunit 1 gene (COI) and the nuclear internal transcribed spacer 2 (ITS2) region. The reagent components and 8 concentrations for the PCR assays were 1x Promega HotStart Master Mix (Promega, Madison, WI) and 0.4mM or 0.5mM for each primer of COI and ITS2, respectively, plus 1µl of isolated DNA template. For the COI assay, universal primers that amplifies a portion of the gene was PT utilized using previously published protocols (Folmer et al., 1994; Saeung et al., 2007), with expected amplicons between 658 to 710 bp. The PCR protocol was as follows: 95°C 1 min; 30 RI cycles of 95°C 30 sec, 48°C 30 sec, 72°C 1 min; 72°C 10 min. For the ITS2 assay, a 650 bp SC region including the gene was PCR amplified using universal primers previously detailed in Djadid et al. (2006). PCR temperature protocol consisted of 95°C for 2 min, 30 cycles of 95°C U for 30 s, 50°C for 30 s, and 72°C for 1 min; followed by 72°C for 5 min. All primers used are Sequence A Primer N listed in Table 1. GGTCAACAAATCATAAAGATATTGG COI 5.8S TE ATGCTTAAATTTAGGGGGTAGTC A 28S ATCACTCGGCTCGTGGATCG Folmer et al. 48 1994 TAAACTTCAGGGTGACCAAAAAATCA COI CC EP HCO2198R Annealing Temperature D LCO1490F M Name Locus Reference Folmer et al. 48 1994 ITS2 Djadid et al. 50 2006 ITS2 Djadid et al. 50 2006 Table 1. Primers used for PCR amplification. PCR products were cleaned using ExoSAP. Amplicons were sequenced using Sanger technology with ABI BigDyeTM Terminator v3.1 chemistry (Thermofisher, Santa Clara, CA) 9 according to manufacturer recommendations and run on a 3130 Genetic Analyzer (Thermo Fisher, Santa Clara, CA). Sequences were analyzed using Codon Code Aligner Program V. 6.0.2 (CodonCode Corporation, Centerville, MA). Sequences from Anopheles from Ethiopia were PT submitted to the National Center for Biotechnology Information's (NCBI) Basic Local Alignment Search Tool (BLAST) (Altschul et al., 1990) against the nucleotide collection in RI Genbank to find other Anopheles sequences that formed high scoring similarity pairs (HSP) at SC the NCBI web server using these values (i.e. max hsp 500, expect threshold 10, word size 28). U 2.4. Phylogenetic Analysis N Phylogenetic analysis was performed with the sequence data collected from the A Anopheles specimens isolated in Ethiopia and closely related within the Anopheles genus found M in Genbank’s nucleotide database ( https://www.ncbi.nlm.nih.gov/nuccore) for both the COI and ITS2 sequences separately. Alignments were created with MAFFT version 7 (Katoh and D Standley, 2013) and were trimmed using MEGA version 7 (Kumar et al., 2016). Phylogenetic TE relationships between the Ethiopian samples we created and samples accessed via Genbank sequences were inferred using a maximum likelihood approach with RAxML (Stamatakis, CC EP 2014). We applied the GTRGAMMA option that uses GTR model of nucleotide substitution with gamma model of rate of heterogeneity. A total 100 runs were completed with a strategy to identify the heuristically-best-scoring tree under the maximum likelihood criterion and rapid A bootstrap analysis in one run. Outgroups were chosen based on availability of data in Genbank and reported relatedness from previous studies (Alam et al., 2008; Harbach and Kitching, 2016). Anopheles implexus and Anopheles sawadwongporni were assigned as the outgroup for COI analysis and ITS2 respectively. RAxML output was viewed in FigTree (Rambaut, 2007), rooted on the outgroup, and a final phylogenetic tree image was created. 10 3. Results Both molecular and morphological data confirmed the larvae were Anopheles stephensi PT based on the following analyses: RI 3.1. Morphological analysis SC In total, 535 larval samples were collected and reared to adulthood. Each adult mosquito emerged from the pupa was identified to species level using morphological characters under a U dissecting microscope, two days of post emergence. The following characteristics were N observed: the palps were smooth with three distinct pale bands and pale spots were also present A in the maxillary palps, the palpomere four is white at the base and apex, and the palpomere five M was completely pale. The legs femora and tibiae were speckled with pale scales. The abdominal D terga II-VIII and sterna V-VIII were covered with pale scales. The wing anal vein had 3 dark CC EP 3.2. Genetic analysis TE spots and its scutal fossa was covered with scattered pale scales. Thirty-six samples were selected at random for genetic analysis. Each specimen had identical COI and ITS2 sequences. BLAST of Genbank nucleotide collection under default A settings with COI and ITS2 from the Kebri Dehar samples as query sequences matched to An. stephensi sequences with 99% identity and 100% identity for COI and ITS2 sequences, respectively. Sequences from Kebri Dehar were deposited in Genbank (MH650999 for ITS2, and MH651000 for COI). 11 Phylogenetic analyses were performed for COI and ITS2 separately to confirm the species identified through BLAST search. COI phylogenetic analysis included 129 top highscoring segment pair (HSP) sequences retrieved from Genbank via Nucleotide BLAST (Altschul PT et al., 1990) analysis from background specimens that had sufficient geographic metadata (Supplemental File 1). Sequences were collected from the following species: An. annularis, An. RI arabiensis, An. argyritarsis, An. azaniae, An. coluzzii, An. culicifacies, An. dthali, An. gambiae, SC An. implexus, An. intermedius, An. jeyporiensis, An. lepidotus, An. minimus, An. minimus C, An. nr. dravidicus YML2012, An. pampanai, An. sawyeri, An. splendidus, An. stephensi, and An. U varuna. An. stephensi sequences were collected from Pakistan, India, Djibouti, Sri Lanka, Iran, N and Saudi Arabia. The final alignment was trimmed to 618 base pairs (Supplemental File 2). In A total, 175 variable sites were identified across all taxa. Within the 44 An. stephensi sequences, 65 M variables sites were identified. Phylogenetic analysis of the alignment revealed strong bootstrap support for the sequence from the Ethiopian sample forming a monophyletic clade with all other A CC EP TE D An. stephensi sequences. The bootstrap value for the key clade was 100% (see arrow in Fig. 3). 12 PT RI SC U N A M D TE CC EP A Figure 3. Phylogeny of COI sequence from Anopheles isolates. Bootstrap values >70 for notable species clades shown at nodes. Nodes without numbers had a value <70. Ethiopian sequenced isolated denoted with arrow. Final 13 A CC EP TE D M A N U SC RI PT ML Optimization Likelihood: -3549.017267. Sequences with no country listed or country incorrectly listed in Genbank are labeled as NCL. Figure 4. Phylogeny of COI sequence from Anopheles stephensi isolates. Bootstrap values >70 shown at nodes. Nodes without numbers had a value <70. Final ML Optimization Likelihood: -1252.592081. Ethiopian sequenced isolated denoted with arrow. 14 To better investigate the relationship with the Ethiopian An. stephensi sequenced isolate with sequenced isolates from other countries, phylogenetic analysis was performed with only An. stephensi COI sequences that contained accurate location details using An. maculatus as the PT outgroup (Figure 4, Supplemental File 3). Our results show the Ethiopian isolate is sister to the clade that contains RI isolates from Pakistan, India, Iran, Sri Lanka, and Djibouti. The bootstrap value of the key clade SC is 100 percent (see arrow in Fig. 4). The analysis also indicated that the Ethiopian An. stephensi is most closely related to a Pakistan sequenced isolate. U Similar results were observed for the ITS2 phylogenetic analysis. ITS2 phylogenetic N analysis included 35 sequences from NCBI (Supplemental File 4) that formed HSPs with the A sequence from the Ethiopian sample forming in the BLAST search and had sufficient geographic M metadata. The following species were included in the analysis: An. stephensi, An. willmori, An. D maculipalpus, An. maculatus, and An. sawadwongporni. The final alignment was trimmed to 350 TE base pairs. In total, 112 variable sites were identified across taxa. All An. stephensi sequences were identical except for one (HQ703001) which had 40 variables sites compared the other An. CC EP stephensi sequences. The ITS2 alignment included multiple gaps and a microsatellite region. As with COI, the Ethiopian ITS2 sequence shared a clade with other An. stephensi isolates to the exclusion of other species with a bootstrap value of 100 percent for the key clade (see arrow in A Fig. 5). 15 PT RI SC U N A M D TE CC EP A Figure 5. Phylogeny of ITS2 sequence from Anopheles stephensi isolates. Bootstrap values >70 shown at nodes. Nodes without numbers had a value <70. Final ML Optimization Likelihood: -1104.708501. Ethiopian sequenced isolated denoted with arrow. 4. Discussion 16 Here we illustrate for the first time the presence of Anopheles stephensi in Ethiopia with both molecular and morphological evidence. Both COI and ITS2 phylogenetic analysis confirm the monophyly of Ethiopian An. stephensi specimens with other An. stephensi specimens to the PT exclusion of other species of Anopheles. The differentiation of An. stephensi isolates from Anopheles gambiae complex isolates, including An. arabiensis, is consistent with previous RI phylogenetic studies (Hao et al., 2017; Jiang et al., 2014). While COI showed more sequence SC diversity across the Anopheles species, ITS2 is more conserved. The morphological data also support the identification of An. stephensi. Morphology of the specimen resembled the features U for the An. stephensi reported in Sri Lanka (Gayan Dharmasiri et al., 2017). N The finding of An. stephensi in Ethiopia is unexpected. Previous sources describe An. A stephensi's range being restricted to east of the Red Sea (Gaffigan; Sinka et al., 2011). One recent M exception is the detection of An. stephensi in Djibouti in 2013 during a malaria outbreak (Faulde D et al., 2014). The authors of the Djibouti report speculate that the source of the outbreak was host TE migration from Ethiopia. While host movement likely plays a role in cross transmission of malaria, it will be very important to investigate how vector movement may also contribute to CC EP transmission across political borders. In our An. stephensi species phylogenetic analysis (Figure 4), the Djibouti sequenced isolate is in a distinct clade to the clade containing the isolate from Ethiopia suggesting different introductions to the Horn of Africa. Interestingly, the sister isolate for Anopheles stephensi in Ethiopia was from Pakistan. Additional genetic analysis of samples A from the Horn of Africa, the Middle East, and other regions within An. stephensi’s range can provide needed information on the origin and movement of An. stephensi. We establish some working hypotheses about the arrival of the Ethiopian An. stephensi in Ethiopia. Some competing scenarios are possible: 1) An. stephensi was recently introduced into 17 Ethiopia. The COI data currently shows that the Ethiopian isolate is most closely related to a Pakistani isolate. Further analysis of mosquitoes from South Asia, the Middle East, and the Arabian Peninsula can provide more granular information about the timing and source of An. PT stephensi in the Horn of Africa. 2) An alternative hypothesis is that An. stephensi has been present in Ethiopia for a long time but undetected. There are some morphological similarities RI between An. stephensi and An. arabiensis, which is considered the dominant vector in most of SC Ethiopia. Therefore, it is possible that An. stephensi has been overlooked or misidentified over the years and came from the other side of the Red Sea a long time ago. Our findings highlight the U need for wider survey of the malaria vectors in Ethiopia. Here we show that sequence-based N methods are particularly useful for differentiating the species that may be morphologically A similar. M Finding An. stephensi in Ethiopia has important public health implications. An. stephensi, D like An. arabiensis, has demonstrated both indoor and outdoor behaviors but is most often TE endophagic (Manouchehri et al., 1976; Tirados et al., 2006). If the same endophagic behavior patterns are observed in Ethiopia, different malaria control strategies may need to be CC EP implemented. Additionally, more studies are needed to determine the vector compentency of An. stephensi in Ethiopia for Plasmodium spp. Wild-caught mosquitoes will be surveyed to confirm the transmission of Plasmodium in the region and to identify which parasite species is being A transmitted. Ethiopia is one of the few countries in Africa where P. vivax and P. falciparum are both actively transmitted (Carter et al., 2018; Tadesse et al., 2018; World Health Organization, 1992). In the Somali Region, P. falciparum is believed to the be the primary species. An. stephensi’s ability to carry both Plasmodium falciparum and Plasmodium vivax, as observed in other areas (e.g. India and Djibouti) (Balabaskaran Nina et al., 2017; Faulde et al., 2014; Thomas 18 et al., 2017), makes it a public health concern for this region. In addition to studies of behavior, range, and vector competence for An. stephensi, studies on An. stephensi's sensitivity or resistance to insecticides will provide important information on the type of vector control PT interventions to implement. To gain better insight into the geographic range of An. stephensi, the next step is to RI conduct mosquito surveys in multiple locations throughout Ethiopia. Much of the effort should SC center on the eastern portion where information on malaria vectors in general is scarce. Both rural and urban surveys are needed, particularly to investigate the role that livestock presence U plays in An. stephensi abundance. All target sites should include both larvae and adult N collections. Sampling ten additional study sites with two sample collection time points will A provide preliminary information on the temporal, epidemiological, geographic, and climatic D design a long-term surveillance study. M variation of the distribution Anopheles population in Ethiopia. This information will be used to TE In conclusion, this study describes the first confirmed report of An. stephensi in Ethiopia. The identification of An. stephensi in Ethiopia has important implications for understanding CC EP malaria transmission in Ethiopia. The results of this study contribute the broader understanding of malaria vector composition in the ESRS and in Ethiopia as a whole. A Abbreviations BLAST: Basic Local Alignment Search Tool COI: Cytochrome c oxidase subunit 1 gene DNA: Deoxyribonucleic Acid ESRS: Ethiopian Somali Regional State 19 FMOH: Federal Ministry of Health ITS2: Internal transcribed spacer 2 region NCBI: National Center of Biotechnology Information PT PCR: Polymerase chain reaction RI Declarations SC Competing interests N published before or submitted elsewhere for publication. U The authors declare that they have no competing interest exist and the manuscript has not been M A Availability of data and material The datasets supporting the conclusions of this article are included within the article and its TE Funding D supplemental files. Sequences have been submitted to NCBI Genbank database. CC EP This study was financially supported by Jigjiga University. This project was partially funded by the University of North Carolina at Charlotte Multicultural Postdoctoral Fellowship. Acknowledgements A Our gratitude goes to Mr. Negib Abdi and Habtamu Atlaw for their facilitating financial and arranging the car for the field work. It is our great pleasure to thank Mr. Geleta Bekele for his technical support in rearing mosquito at field laboratory. The authors would also like to thank Dr. Ronald Clouse for his helpful suggestions. We acknowledge the University of North 20 Carolina at Charlotte and entities within (i.e. the Department of Bioinformatics and Genomics, The College of Computing and Informatics, Academic Affairs, and the Graduate School) for PT salary and logistical support. National Statistics. 2007. http://www.csa.gov.et/ U World Malaria Report. World Health Organization. 2017. SC Malaria programme review - Aide Memoire. Ministry of Health 2011. RI References N Alam MT, H Bora, MK Das and YD Sharma. The type and mysorensis forms of the Anopheles A stephensi (Diptera: Culicidae) in India exhibit identical ribosomal DNA ITS2 and M domain-3 sequences. Parasitol Res. 2008;103:75-80 Alemu A, G Abebe, W Tsegaye and L Golassa. Climatic variables and malaria transmission D dynamics in Jimma town, South West Ethiopia. Parasit Vectors. 2011;4:30 TE Altschul SF, W Gish, W Miller, EW Myers and DJ Lipman. Basic local alignment search tool. J CC EP Mol Biol. 1990;215:403-10 Balabaskaran Nina P, AK Mohanty, S Ballav, S Vernekar, S Bhinge, M D'Souza, et al. Dynamics of Plasmodium vivax sporogony in wild Anopheles stephensi in a malaria- endemic region of Western India. Malar J. 2017;16:284 A Bekele A. Weekly Epidemiological Bulletin. Ethiopian Public Health Institute. 2016. Carter TE, SK Mekonnen, K Lopez, V Bonnell, L Damodaran, A Aseffa, et al. Glucose-6Phosphate Dehydrogenase Deficiency Genetic Variants in Malaria Patients in Southwestern Ethiopia. Am J Trop Med Hyg. 2018;98:83-87 21 Djadid ND, S Gholizadeh, M Aghajari, AH Zehi, A Raeisi and S Zakeri. Genetic analysis of rDNA-ITS2 and RAPD loci in field populations of the malaria vector, Anopheles stephensi (Diptera: Culicidae): implications for the control program in Iran. Acta Trop. PT 2006;97:65-74 Faulde MK, LM Rueda and BA Khaireh. First record of the Asian malaria vector Anopheles RI stephensi and its possible role in the resurgence of malaria in Djibouti, Horn of Africa. SC Acta Trop. 2014;139:39-43 Folmer O, M Black, W Hoeh, R Lutz and R Vrijenhoek. DNA primers for amplification of U mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol N Mar Biol Biotechnol. 1994;3:294-9 A Gaffigan TV, R. C. Wilkerson, J. E. Pecor, J. A. Stoffer, and T. Anderson. Systematic Catalog of M Culicidae. 2018. The Walter Reed Biosystematics Unit. http://www.mosquitocatalog.org/default.aspx. Accessed February 12018 D Gayan Dharmasiri AG, AY Perera, J Harishchandra, H Herath, K Aravindan, HTR Jayasooriya, TE et al. First record of Anopheles stephensi in Sri Lanka: a potential challenge for CC EP prevention of malaria reintroduction. Malar J. 2017;16:326 Gillies MT and M Coetzee. A supplement to the Anophelinae of Africa south of the Sahara (Afrotropical region). South African Institute for Medical Research; 1987 A Glick JI and Walter Reed Biosystemsatics Unit. Illustrated Key to the Female Anopheles of Southwestern Asia and Egypt (Diptera: Culicidae). Defense Technical Information Center; 1992 22 Gone T, M Balkew and T Gebre-Michael. Comparative entomological study on ecology and behaviour of Anopheles mosquitoes in highland and lowland localities of Derashe District, southern Ethiopia. Parasit Vectors. 2014;7:483 PT Hao YJ, YL Zou, YR Ding, WY Xu, ZT Yan, XD Li, et al. Complete mitochondrial genomes of Anopheles stephensi and An. dirus and comparative evolutionary mitochondriomics of 50 RI mosquitoes. Sci Rep. 2017;7:7666 SC Harbach RE and IJ Kitching. The phylogeny of Anophelinae revisited: inferences about the origin and classification of Anopheles (Diptera: Culicidae). Zoologica Scripta. U 2016;45:34-47 N Jiang X, A Peery, AB Hall, A Sharma, XG Chen, RM Waterhouse, et al. Genome analysis of a A major urban malaria vector mosquito, Anopheles stephensi. Genome Biol. 2014;15:459 M Katoh K and DM Standley. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol Biol Evol. 2013;30:772-80 D Kenea O, M Balkew and T Gebre-Michael. Environmental factors associated with larval habitats TE of anopheline mosquitoes (Diptera: Culicidae) in irrigation and major drainage areas in CC EP the middle course of the Rift Valley, central Ethiopia. J Vector Borne Dis. 2011;48:85-92 Kenea O, M Balkew, H Tekie, T Gebre-Michael, W Deressa, E Loha, et al. Human-biting activities of Anopheles species in south-central Ethiopia. Parasit Vectors. 2016;9:527 A Kibret S, GG Wilson, H Tekie and B Petros. Increased malaria transmission around irrigation schemes in Ethiopia and the potential of canal water management for malaria vector control. Malar J. 2014;13:360 Krafsur ES. The bionomics and relative prevalence of Anopheles species with respect to the transmission of Plasmodium to man in western Ethiopia. J Med Entomol. 1977;14:180-94 23 Kumar S, G Stecher and K Tamura. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol Biol Evol. 2016;33:1870-4 Lelisa K, A Asale, B Taye, D Emana and D Yewhalaw. Anopheline mosquitoes behaviour and PT entomological monitoring in southwestern Ethiopia. J Vector Borne Dis. 2017;54:240248 RI Manouchehri AV, E Javadian, N Eshghy and M Motabar. Ecology of Anopheles-Stephensi SC Liston in Southern Iran. Tropical and Geographical Medicine. 1976;28:228-232 Massebo F, M Balkew, T Gebre-Michael and B Lindtjorn. Blood meal origins and insecticide U susceptibility of Anopheles arabiensis from Chano in South-West Ethiopia. Parasit N Vectors. 2013;6:44 A Massebo F, M Balkew, T Gebre-Michael and B Lindtjorn. Zoophagic behaviour of anopheline M mosquitoes in southwest Ethiopia: opportunity for malaria vector control. Parasit Vectors. 2015;8:645 D Mohammed Y. Malaria Outbreak Investigation, Erer District, Ethiopia Somali Region, Eastern TE Ethiopia, Nov 2012. 2015. CC EP Rambaut A. FigTree, a graphical viewer of phylogenetic trees. 2007 Saeung A, Y Otsuka, V Baimai, P Somboon, B Pitasawat, B Tuetun, et al. Cytogenetic and molecular evidence for two species in the Anopheles barbirostris complex (Diptera: Culicidae) in Thailand. Parasitol Res. 2007;101:1337-44 A Simane B, H Beyene, W Deressa, A Kumie, K Berhane and J Samet. Review of Climate Change and Health in Ethiopia: Status and Gap Analysis. Ethiop J Health Dev. 2016;30:28-41 24 Sinka ME, MJ Bangs, S Manguin, T Chareonviriyaphap, AP Patil, WH Temperley, et al. The dominant Anopheles vectors of human malaria in the Asia-Pacific region: occurrence data, distribution maps and bionomic precis. Parasit Vectors. 2011;4:89 PT Stamatakis A. RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics. 2014;30:1312-3 RI Tadesse FG, HC Slater, W Chali, K Teelen, K Lanke, M Belachew, et al. The Relative SC Contribution of Symptomatic and Asymptomatic Plasmodium vivax and Plasmodium falciparum Infections to the Infectious Reservoir in a Low-Endemic Setting in Ethiopia. U Clin Infect Dis. 2018;66:1883-1891 N Taye A, M Hadis, N Adugna, D Tilahun and RA Wirtz. Biting behavior and Plasmodium A infection rates of Anopheles arabiensis from Sille, Ethiopia. Acta Trop. 2006;97:50-4 M Thomas S, S Ravishankaran, NA Justin, A Asokan, MT Mathai, N Valecha, et al. Resting and Malar J. 2017;16:111 D feeding preferences of Anopheles stephensi in an urban setting, perennial for malaria. TE Tirados I, C Costantini, G Gibson and SJ Torr. Blood-feeding behaviour of the malarial CC EP mosquito Anopheles arabiensis: implications for vector control. Med Vet Entomol. 2006;20:425-37 World Health Organization. Entomological field techniques for malaria control. I. Learner's A guide. 1992 25